Pair programming.
On this assignment, just like the last one,
you are encouraged (not required) to work with
a partner provided you practice pair programming
(same rules as last assignment).
|
What are the main goals of this assignment? Use a symbol table, learn about natural language processing, and learn about Markov models.
What is the origin of the Markov text generator? It was first described by Claude Shannon in 1948. The first computer version was apparently written by Don P. Mitchell, adapted by Bruce Ellis, and popularized by A. K. Dewdney in the Computing Recreations section of Scientific American. Brian Kernighan and Rob Pike revived the program in a University setting and described it as an example of design in The Practice of Programming. The program is also described in Jon Bentley's Programming Pearls.
Do I have to implement the prescribed API? Yes, or you will lose a substantial number of points.
How do I read in the input text from standard input? Use StdIn.readAll().
Given a string s, is there an efficient way to extract a substring? Use s.substring(i, i+k) to get the k-character substring starting at i. In Java, this operation takes constant time, regardless of the size of k.
How do I emulate the behavior of a circular string? There are a number of approaches. One way is to concatenate the first k characters to the end of the input text.
How do I convert a char to an int? A char is a 16-bit (unsigned) integer. Java will automatically promote a char to an int if you use it as an index into an array.
How can I define a global constant that can be accessed by all of the methods within a class? You can define a final instance variable so that each object has its own constant.
If all of the objects within the class use the same constant, use the static modifier so that one global constant is shared by each object in the class.private final int ASCII = 128;
private static final int ASCII = 128;
Should my program generate a different output each time I run it? Yes.
My random text ends in the middle of a sentence. Is that OK? Yes, that's to be expected. We recommend adding a StdOut.println(); statement after the last character you print out.
For which values of k should my program work? It should work for all well-defined values of k from and including 0 to and including the length of the input text. Naturally, as k gets larger, your program will use more memory and take longer.
I get an OutOfMemoryException. How do I tell Java to use more of my computer's memory? Depending on your operating system, you may have to ask the Java Virtual Machine for more main memory beyond the default.
The 100m means 100MB, and you should adjust this number depending on the size of the input text.% java -Xmx100m TextGenerator 7 1000 < input.txt
|
Thoroughly test your MarkovModel. We provide a main() as a start to your testing.
If your method is working properly, you will get the following output:public static void main(String[] args) { MarkovModel mod1 = new MarkovModel("i am sam. sam i am", 3); StdOut.println("freq(\"sam\", ' ') = " + mod1.freq("sam", ' ')); StdOut.println("freq(\"sam\", '.') = " + mod1.freq("sam", '.')); StdOut.println("freq(\"mi \") = " + mod1.freq("mi ")); StdOut.println("freq(\"sam\") = " + mod1.freq("sam")); StdOut.println(); String text = "now is the time. now is the time to eat. " + "now is the time to live."; MarkovModel mod2 = new MarkovModel(text, 7); StdOut.println("freq(\"now is\", ' ') = " + mod2.freq("now is ", ' ')); StdOut.println("freq(\"now is\", 't') = " + mod2.freq("now is ", 't')); StdOut.println("freq(\"now is\") = " + mod2.freq("now is ")); }
%java MarkovModel freq("sam", ' ') = 1 freq("sam", '.') = 1 freq("mi ") = 1 freq("sam") = 2 freq("now is", ' ') = 0 freq("now is", 't') = 3 freq("now is") = 3
An order-0 Markov model generates a random sequence of letters where each letter appears with probability proportional to its frequency in the input text. For input17.txt there are 9 g's, 7 a's, and 1 c. So we want the probability of generating a 'g' to be 9/17, an 'a' to be 7/17, and a 'c' to be be 1/17. In a sequence of 100 characters, we'd therefore expect on average about 53 g's, 41 a's, and 6 c's.
% java TextGenerator 0 100 < input17.txt gaaagaacagcagacgacggaagaaggaggaaaaggaggggaggggggaggaggaagggagaaaggagacagcggaggggacgggaggagaggaggagag
For input17.txt, the next character after "ga" is 'a' with probability 1/5 and 'g' with probability 4/5. If you run the following command 10 times, you should expect (on average) to see "gag" 8 times and "gaa" 2 times.
% java TextGenerator 2 3 < input17.txt gag
|
These are purely suggestions for how you might make progress. You do not have to follow these steps.
|